Ned Lab's Protocols

 

 

AFM

 

The followings are some tips on how to protect our scanner from the damage:

 

1. The computer should be on whenever the controller is on! Turn the computer on before the nanoscope controller!

 

2. On the scan control panel, avoid OFFSET voltages outside of +/- 150V for periods of more than about an hour. Whenever itÕs possible, reset them to zero.

 

3. Avoid using maximum scan size for long periods (for instance, size greater than 40- 120 um) if not necessary.

 

4. Avoid leaking when organic solvents were used (isopropanol) during imaging.

 

5. The right way to start and shut down the scope should be as following:

On:  Main power---computer--controller

Off: Controller--Computer--main power

 

(This will protects the DSP, digital signal processor, and interface boards from damage by large random current)

 

6. Fluid cell is a very fragile since it is made of the glass itself. Avoid dropping it to the floor when you load the tip or install it into the scope head. Please don't press the spring clip too hard when you load the tip. 

 

7. If you encounter with the extreme noising signal or the blurring during the imaging, you should check that the air table is functioning properly, the mica sticks tightly with the magnet plate and the magnet plate contact directly to the  tube scanner. (make sure that  the silicon seal does not get in the way)

 

 

Formation of Hydrogen-bonded Complexes:

 

 

1. Complexes are formed by mixing a stoichiometric quantity of each strand, as estimated by OD260. 

 

2. This mixture is then heated to 95 ûC for 5 minutes and cooled to the desired temperature by the following protocol:  20 minutes at 65 ûC, 15 minutes at 50 ûC, 20 minutes at 37 ûC, and if desired, 20 minutes at room temperature.

 

3. When slow annealing is desirable, the mixture is heated at 95 ûC for 5 minutes, then transferred to a 2-liter water bath, preheated to about 90ûC and placed inside a Styrofoam box, and allowed to cool slowly to the desired temperature over the period of two days.

 

 

3-D Crystal (DNA treatment before the setting-up)

 

 

1. Purify strands using standard purification. Overnight dialysis in 2L of dd water to help get rid of salt and EB.  Filter strands with 0.22um microcentrifuge filters. 

 

2. Filter dd water and 10X TAE/Mg buffer using 0.22um syringe filters. 

 

3. Add water, buffer, and DNA to the 1.5 ml tubes.  Vortex for at least 1 min, spin down.

 

4. For slow anneal:

 

Bring 2 L of d water to boil.  Place in styrofoam box.  After ~24hrs, place box in cold room for at least another 12 hrs.

   

5. For fast anneal:

 

5 min at 90¡, 30 min at 65¡, 30 min at 50¡, 30 min at 37¡ in heating blocks

 

Denaturing Gels: 

 

1. These gels contain 8.3 M urea and are run at 55 ûC.

 

2. The running buffer consists of 89 mM Tris.HCl, pH 8.0, 89 mM Boric acid, 2 mM EDTA (TBE). 

 

3. The sample buffer consists of 10 mM NaOH, 1 mM EDTA, containing trace amount of Xylene Cyanol FF and Bromophenol Blue tracking dye.

 

4. Gels are run on a Hoefer SE 600 electrophoresis unit at 55 ûC (31 V/cm, constant voltage). 

 

5. When further denaturation is required, a 6% acrylamide gel solutions containing 7.0 M urea and 41 % formamide, or a 4% acrylamide gel solutions containing 6.8 M urea and 47 % formamide is substituted for a regular denaturing gel.

 

 

EXO Digestion:

 

1. Mix DNA, EXO buffer and dd-H2O to bring to certain volume (30 ul, generally) of mixture which is equivalent to 1x EXO buffer.

 

2. Add 1ul Exo(I) and 1ul Exo(III) respectively.

 

3. Incubate at 37 oC for about 2 hours.

 

4. For some complicated molecule.

 

The special treatment before Exo is needed: Heating to 90 oC for 10min, then cooling to 0 oC quickly by put it on ice.  Then step 2-3.

 

 

Fe-EDTA Cutting

 

Solutions( All must be fresh):

 

I. EDTA(mw 372.2)

          20X (4mM),  0.0744g in 50ml water

            final cutting conc: 0.2mM

II. L-Ascorbic Acid ( Sodium Salt) (mw 198.1)

         10X soln (10mM),  0.09905g in 50ml water

          final cutting conc: 1mM

III. H2O2

       10X=1.5% ,  50ul 30% to 1000ul

      final cutting conc: 0.15%

IV. Fe(II) (Ammonium iron(II) Sulfate Hexahydrate) (mw 392)

      20X = 2mM, 0.0392g in 50ml water

       final cutting conc=0.1mM

V. thiourea(mw 76.12)

           10X = 10 mM,  0.03806g in 50ml water

            final cutting conc: 1mM

 

Procedure:

 

1. Anneal complex, put it on ice.

 

2. Place 1ml of each of the following solns in 1.5 ml tubes and place on ice for 1 hr

    1.L-ascorbic acid

    2. Fe-EDTA(each 500ul)

    3. H2O2

    4. thiourea

 

3. Placing 6ul DNA in the tube, and add 1ul of solns I,II,III one by one to the wall of the tube. Do not mix I.II.III until III is added. Mixing soln with the pipette tip ( not vertex) and push the mixture into the DNA solution.

 

4. After 100 secs (exactly), add 1ul thiourea directly to soln and vortex. Then add 1ml 100% ETOH and place into dry ice

 

5. Ethanol Precipitation and recover DNA.

 

Fill-in Reaction by Klenow Fragment (Adding Cy3 fluorescence dye to a DNA strand)

 

Anneal the DNA template and primer in 1X Eco Pol buffer (polymerase reaction buffer). Then add the specified free dNTPs, dCTP-Cy3 and the desired amount of klenow fragment polymerase, place in the 37oC incubator for about one and half hours. Then perform ethanol precipitation and purification.

 

 

Kination (Radioactive labeling) by the Phosphorylation

 

10 ul reaction:

 

Step 1.        1 pmole DNA (1 ul)

                    10x kination buffer (1 ul)

                    2.2 pmol labeled ATP (1 ul)

                    1 ul kinase (Diluted, 3 units/ul)

                    6 ul dd water.

                    The reaction proceeds at 37 degree in about 1 hours.

 

Step 2. Kinase is inactivated at 90 degree in about 5 min and filtered through the G-25 microspin  column (Pharmacia) to remove unincorporated g-32P-ATP

 

Step 3. Phenol extraction and ethanol precipitation. Dry down the liquid and hot DNA is purified by 10 to 15 % denaturing gel. 

 

Step 4. Salts in eluted DNA is removed by. Purified DNA is ready for annealing.

 

 

 

Ligation:

 

1. Make reaction solutions ( total V ul ) :

  

    DNA strands

   V/10 ul 10X ligation buffer

   dd H2O to V ul

 

2. Annealing to 4 oC as the protocol described in the annealing protocol.

 

3. Add  ligase and stand at 16 oC for at least 16 hrs.

 

4. Add one more time ligase at  16 oC  if it is necessary.

  

 

 

Non-Denaturing Gels:

 

1. The running buffer consisting of 40 mM Tris-HCl (pH 8.0), 20 mM Boric acid, 2 mM EDTA and 12.5 mM magnesium acetate (TAE/Mg).

 

2. The DNA is dissolved in 10 uL of TAE/Mg buffer. 10X Tracking dye (1 uL) containing TAEMg, 50% glycerol and trace amount of Bromophenol Blue and Xylene Cyanol FF is added to  the sample buffer. 

 

3. Gels are run on a Hoefer SE-600 gel electrophoresis unit at 12-16 V/cm at  the desired temperature.

 

 

Phenol Extraction

 

1. Add an equal vol. of saturated phenol to the DNA solution.( 0.1 -0.4 ml, monovalent cation smaller than 0.5 M , high salt causes inversion of aqueous and organic phases , the organic phase should be yellow in this case. 50 -100 ul is too small, need to be diluted.

 

2.Vortex vigorously for 10 sec.

 

3. Spin 15 sec at room temp. in microcentrifuge.  If solution is viscous and contain a large amount of protein, spin longer ( 1 to 2 min ).

 

4. Carefully remove the top aqueous phase to a new tube.

 

5. Add an equal vol. of saturated phenol/ chloroform (1:1) to the DNA solution. Repeat 2-4.

 

6. Add an equal vol. of chloroform to the DNA solution. Repeat 2-4.

 

 

 

Purification of DNA:. 

 

 

1. DNA strands have been purified by denaturing gel electrophoresis.

 

2. Eithidium bromide stained bands are cut out of 10-20% denaturing gels and eluted in a solution containing 500 mM ammonium acetate, 10 mM magnesium acetate and 1 mM EDTA.

 

3. The eluates are subjected to extraction with n-butanol to remove the ethidium, followed by ethanol precipitation.

 

 

 

Recovering the DNA from the Gel

 

1. Cut out the band with a razor blade.

 

2. Chop the slice into fine pieces.

 

3. Transfer them into a 1.5 -ml microcentrifuge tube (Larger tube for larger volume)

 

4. Add the elution buffer (0.5M ammonium acetate,  1 mM EDTA, 10 mM Tris-HCl, pH=7.6),  at least twice of the volume of the gel.

 

5. Shake at 4¡C overnight.

 

6. Spin 1 min and collect the supernatant.

 

7. Recover any residual DNA by rinsing with small volume of elution buffer. Spin and combine the supernatants.

 

8. The eluates are subjected to extraction with n-butanol to 1/3 of the original volume and add 1ml 100% ethanol.

 

9. Place the tube in dry ice for 45 mins.

 

10. Spin at 10,000 rpm (13,000 X g) for 30 min in microcentrifuge and discard the supernatant.

 

11. Wash the pellet with 1ml 70 % ethanol and spin 7 mins. Then dry and resuspend in TE buffer.

 

 

RESTRICTION:

           

1. Mix:

 

DNA,

restriction buffer,

dd-H2O

                       

2. Anneal DNA by keeping at

 

90 C for 5 min,

65 C for 15 min,

37 C for 20 min,

RT for 20 min.

                       

3. Add certain amount of restriction enzyme (no more than 1/10 of reaction mixture).

                       

4. Incubate at the recommended temperature for the desired time.

 

 

Maxam-Gilbert Sequencing

 

1. 20 ul labeled DNA in water( about 50k)

 

2. Keep it in 0 degree for 1 hr.

 

3. Add 50 ul Formic acid, votex, keep in RT 4 mins.

 

4. Add: 180 ul HZ-stop solution( 2ml includes 5 ul tRNA, 40 ul EDTA, 200 ul NaAc and 1750 ul water)

           

           1000 ul ethanol

 

5. Keep in dry ice 30 mins.

 

6. Spin 20 mins, 1ml 70% ethanol washing , spin 5 mins, dry down.

 

7. Add 1M peperidine 100 ul

 

    90 degree 20 mins.

 

8. Add 20 ul water and dry down. repeat several times.

 

 

SoxR Binding Assay      

 

1. Anneal DNA complex in 10mM Tris-HCl, 75mM KCl, 10% glycerol, 2mM DTT SoxR binding buffer first. Then add the desired amount of SoxR protein, stay 30 min. at r.t..

 

2. Gel running buffer: 20mM Tris-HCl, 3mM sodium acetate, 1mM EDTA

 

 

Streptavidin Paramagnetic Particles:

 

                       

1. Take certain amount (depends on the quantity of DNA, calculated according to the binding capacity which is 0.75-1.25 nmole/mg) of magnetic particles (Promega , 1mg/ml), using sterile tip, put the tube on Magnetic Stand in which the particles stick on one side of  the tube.

 

2.  Discard the supernatant.

 

3. Wash the particles three times using PBS(1mg/ml BSA and 0.02% NaAzide).

 

4. Wash the particles three times using the desired 1x buffer.

 

5. Add the DNA samples with Biotin to the magnetic particles pellet, keep at R.T. for 20 mins for the coupling reaction.

 

6. Put the tube back on Magnetic Stand for 2 mins. Collect the supernatant which contains only DNA without the Biotin.

 

7. You may wash the particles once using 1x buffer and combine two solutions .

 

 

AFM Imaging (tapping in buffer)

 

 

1 Tip

For the tapping mode imaging in buffer, use the short cantilever (either skinny or fat) on the AFM chip.

 

2 Sample preparations

The protocol for preparing sample is to put 5ul DNA lattice in TAE/Mg or HEPES /Mg on the mica, let it sit for 0.5 - 1 min, then add 25ul of buffer. An additional 30ul buffer will be applied to the tip with fluid cell Ôright side upÕ so that the drop is hanging.    

 

3 Laser align

Make sure to align the photodiodes both side to side (horizontal difference signal) by align the laser in ÔAFM & LFMÕ mode and aligning the laser in top to bottom (vertical difference signal) in ÔTM AFMÕ mode. Both vertical and horizontal difference should be around 0. When laser is properly aligned, go to auto tune icon and ask for a amplitude of 0.5 volts. The resonance for the small skinny tip should fall between 9and 9.5 kHz. 

 

4 Imaging

Do the engage. 

 

Setting for tapping in buffer:

 

Scan control:

 

Scan size: 5um-10um

Scan angle : 0

Scan rate: 3-6 Hz

 

Feedback control:

Integral gain: 0.4-0.7

Proportional gain: 0.6-0.8

Channel 1: 6nm-10nm of height contrast (for DNA)

Channel 2: 1volt of amplitude contrast

 

5 DonÕt change other settings except the ones mentioned in 4 before you counsel the persons who charge of AFM.

 

6 DonÕt put back the used tips into the new tip box. Before concluding the tip is bad and changing it, make sure that you did everything right and every setting is correct.

 

Protocols for Training Experiments

 

 

J1 Junction

 

Purposes of the training: learn the basics of Gel electrophoresis.

 

The sequences of J1-1, J1-2, J1-3 and J1-4

 

J1-1(16mer): CGCAATCCTGAGCACG

J1-2(16mer): CGTGCTCACCGAATGC

J1-3(16mer): GCATTCGGACTATGGC

J1-4(16mer): GCCATAGTGGATTGCG

 

The first, four 20% denaturing gels need to be prepared (Picture 1). About 3OD of each strand is loaded to the one denaturing gel. These gels contain 8.3 M urea and are run at 55 ûC. The running buffer consists of 89 mM Tris.HCl, pH 8.0, 89 mM Boric acid, 2 mM EDTA (TBE). The sample buffer consists of 10 mM NaOH, 1 mM EDTA, containing trace amount of Xylene Cyanol FF and Bromophenol Blue tracking dye. Gels are run on a Hoefer SE 600 electrophoresis unit at 55 ûC (30 V/cm, constant voltage) (Picture 2).

 

                

 

                                                               Picture 1

 

Ethidium bromide stained main bands, which contain the whole-length products, are cut of 20% denaturing gels with a razor blade and transfer to 1.5 ml microcentrifuge tube. Then add the elution buffer containing 500 mM ammonium acetate, 10 mM magnesium acetate and 1 mM EDTA and shake overnight. Spin 1 min and collect the supernatant. The eluates are subjected to extraction with n-butanol to 1/3 of the original volume and add 1ml 100% ethanol. Place the tube in dry ice for 45 mins and Spin at 10,000 rpm (13,000 X g) for 30 min in microcentrifuge. Discard the supernatant and wash the pellet by adding 1ml 70 % ethanol and spinning 7 mins. Then the strands are dried and resuspend in TE buffer.

 

                

 

                                                             Picture 2

 

Quantify DNA by measuring the absorbance at 260nm wavelength. We assume that roughly 1OD equals to 35 ug DNA and the molecular weight for a single base is 330.

 

Usually a purity-check gel need be done to assure the quality of the purified strands. Make sure that the mobility of the strands corresponds to the expected strand length comparing the DNA ladder marker and no visible lower bands, which indicate the partial products (Picture 3).

 

Complexes are formed by mixing a stoichiometric quantity of each strand, as estimated by OD260, in the normal TAE/Mg buffer and DNA concentration is 4 uM. The 10 uL mixture is then heated to 95 ûC for 5 minutes and cooled to the desired temperature by the following protocol: 20 minutes at 65ûC, 15 minutes at 50ûC, 20 minutes at 37ûC, 20 minutes at room temperature and 20 minutes at 4ûC.

 

Add 1 uL 10X tracking dye which contains 1X TAE/Mg, 50% glycerol and trace amount of Bromophenol Blue and Xylene Cyanol FF to the annealed samples. Gel is run on a Hoefer SE-600 gel electrophoresis unit at 12-16 V/cm at 4ûC. The running buffer consists of 40 mM Tris-HCl (pH 8.0), 20 mM Boric acid, 2 mM EDTA and 12.5 mM magnesium acetate (aka normal TAE/Mg buffer).

Make sure that the lane in which contains complex has no higher or lower bands (Picture 4).

 

                        

 

                                                                Picture 3

 

                        

 

                                                                 Picture 4

Reference:

 

Kallenbach, N.R., Ma, R.-I., Seeman, N.C., An Immobile Nucleic Acid Junction Constructed from Oligonucleotides, Nature 305, 829-831 (1983).

JY21 Junction

 

Purposes of the training: learn enzymatic reactions (Kination, Ligation and Exonucleases) and radiation safety.

 

The sequences of JY21-1, JY21-2 and JY21-3

JY21-1(19mer): GCTCACGCCAGATGGGTGC

JY21-2(21mer): GACCGCACCCATCCTGCTACG

JY21-3(22mer): GGTCCGTAGCAGTGGCGTGAGC

 

At first, the three strands need be purified as the J1 experiment. The strand 2 is the report strand to which we need add P31 or P32 (radioactive) individually by the kination reaction.

The following protocol is for Radioactive (aka hot) labeling of the strand 2.

We use 10 ul reaction volume here. The first we add the following reagents in the order:

 1 pmole DNA (1 ul), 10x kination buffer (1 ul), 6 ul dd water, 2.2 pmol labeled ATP (1 ul), 1 ul kinase (Diluted, 3 units/ul). Warning: after adding the kinase, you canÕt vortex the mixture.

The reaction proceeds at 37 degree for about 1 hour. Kinase is inactivated at 90 degree for about 5 min and filtered through the G-25 microspin column (Pharmacia) to remove unincorporated g-32P-ATP. Followed by phenol extraction and ethanol precipitation. Dry down the liquid and hot DNA is purified by 20 % denaturing gel. The gel is exposed to a X-ray film and cut the main band according to the autoradiograph. Recover the DNA strand as the J1 experiment. When you do the radiation experiment, you need always work behind the shield in the designated area with your radiation badge (Picture 5).

           

                                                       Picture 5

You also need to repeat the same procedure in large scale by using the normal (aka cold) ATP (non-radioactive).

 

Now you are ready to anneal the JY21 complex. In 20 uL reaction volume, we will add 1 ul 10X ligation buffer, 20 pmole of strand 1 and 3, 19 pmole of cold-phosphorylated strand 2 and trace of hot-phosphorylated strand 2, then add water to 20 ul. Follow the annealing procedure as the J1 experiment. After the mixture was cooled at 4ûC, add another 1 ul 10X ligation buffer and 1 ul ligase (10 units/ul). Incubate the mixture at 16ûC for 16 hrs and terminate the reaction by heating at 90ûC for 5 mins.

 

Take 10 ul from the reaction volume and add 0.5 ul Exo I and Exo III respectively. Incubate at 37ûC for 2 hrs and terminate the reaction by heating at 90ûC for 5 mins. The both samples of Exo-treated and non-Exo-treated are ready to load on four different percentage gels (6%, 8%, 10% and 12%). The mobility of all the bands were measured and Ferguson plot was made from those data. (See Picture 6)

 

                                                          Picture 6

 

Reference:

 

R.-I. Ma, N.R. Kallenbach, R.D. Sheardy, M.L. Petrillo and N.C. Seeman, 3-Arm Nucleic Acid Junctions Are Flexible.  Nucleic Acids Research 14, 9745-9753 (1986).

 

 

 

 

 

 

 

 

AB* DNA Array

 

Purposes of the training: learn how to assemble 2D DNA array and observe it by AFM with the tapping mode.

 

The sequences of AB*:

 

A1(47mer): GATGGCGACATCCTGCCGCTATGATTACACAGCCTGAGCATTGACAC

A2(21mer): GTAGCGCCGTTAGTGGATGTC

A3(42mer): TGTAGTATCGTGGCTGTGTAATCATAGCGGCACCAACTGGCA

A4(32mer): GACTGCGTGTCAATGCTCACCGATGCAACCAG

A5(48mer): CTGACGCTGGTTGCATCGGACGATACTACATGCCAGTTGGACTAACGG

B1(69mer): CGCTACCGTGCATCATGGACTAACCAGTGCTCGCTGATTTTTCAGCGAGTTACCGCATCGGACAGCAGC

B2(22mer): CGTCAGGCTGCTGTGGTCGTGC

B3(42mer): AGTACAACGCCACCGATGCGGTCACTGGTTAGTGGATTGCGT

B4(31mer): GCCATCCGTCGATACGGCACCATGATGCACG

B5(70mer): GCAGTCGCACGACCTGGCGTCTGTTGGCTTTTGCCAACAGTTTGTACTACGCAATCCTGCCGTATCGACG

 

The DNA strands need be purified as the J1 experiment. Usually we use 20% gel to purify the strand below 35mer, 15% gel to purify the strand between 35mer and 55mer and 10% gel to purify the strand above 55mer.

 

Complexes are formed by mixing a stoichiometric quantity of each strand, as estimated by OD260. Exact stoichiometry is determined, if necessary, by titrating pairs of strands designed to hydrogen bond together and visualizing them by nondenaturing gel electrophoresis; absence of monomer is taken to indicate the endpoint. All 20 strands are mixed either in 10 mM HEPES (pH 7.8), 6 mM MgCl2, and 1 mM EDTA (for restriction) or 20 mM Tris (pH 7.6) and 10 mM MgCl2 (for restriction or ligation). The final concentration of DNA is 0.4 M, and the final volume is 50 L. The tube containing the DNA solution is put in about 2 L of boiled water and placed in a Styrofoam box for at least 40 h to facilitate hybridization. Warning: for sealing the tube well, we wrap it with parafilm first and use the clamp afterward.

 

After the annealing is finished, a 5 L aliquot of a solution containing arrays is deposited on a freshly cleaved mica surface for 1 min and 25ul of buffer is added. An additional 30ul buffer will be applied to the tip with fluid cell Ôright side upÕ so that the drop is hanging. For the tapping mode imaging in buffer, use the short cantilever (either skinny or fat) on the AFM chip.

 

Make sure to align the photodiodes both side to side (horizontal difference signal) by align the laser in ÔAFM & LFMÕ mode and aligning the laser in top to bottom (vertical difference signal) in ÔTM AFMÕ mode. Both vertical and horizontal difference should be around 0. When laser is properly aligned, go to auto tune icon and ask for the amplitude of 0.5 volts. The resonance for the small skinny tip should fall between 9and 9.5 kHz.

 

After the AFM is tuned properly, do the engage and enjoy the beautiful images. See Picture 7.

                                                                  Picture 7

 

The following is the setting for tapping in buffer:

 

Scan control:

 

Scan size: 5um-10um

Scan angle : 0

Scan rate: 3-6 Hz

 

Feedback control:

 

Integral gain: 0.4-0.7

Proportional gain: 0.6-0.8

Channel 1: 10nm of height contrast (for DNA)

Channel 2: 1volt of amplitude contrast

 

The followings are some tips on how to protect our scanner from the damage:

 

1. The computer should be on whenever the controller is on! Turn the computer on before the nanoscope controller!

2. On the scan control panel, avoid OFFSET voltages outside of +/- 150V for periods of more than about an hour. Whenever itÕs possible, reset them to zero.

3. Avoid using maximum scan size for long periods (for instance, size greater than 40- 120 um) if not necessary.

4. Avoid leaking when organic solvents were used (isopropanol) during imaging.

5. The right way to start and shut down the scope should be as following:

On:  Main power---computer--controller

Off: Controller--Computer--main power

 (This will protects the DSP, digital signal processor, and interface boards from damage by large random current)

6. Fluid cell is a very fragile since it is made of the glass itself. Avoid dropping it to the floor when you load the tip or install it into the scope head. Please don't press the spring clip too hard when you load the tip.

 

Reference:

 

E. Winfree, F. Liu, L. A. Wenzler, and N.C. Seeman,  Design and Self-Assembly of Two-Dimensional DNA Crystals, Nature 394, 539-544 (1998).